Software:Article Title: Functional heterogeneity of POMC neurons relies on mTORC1 signaling.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Database for Annotation, Visualization and Integrated Discovery (DAVID) Bioinformatics Resources 6.7 Dennis et al., 2003 https://david.ncifcrf.gov/ Genepattern 3.9.8 Reich et al., 2006 https://cloud.genepattern.org/gp/pages/ login.jsf HALO Indica Labs Inc. https://indicalab.com/halo/ ImageJ Schneider et al., 2012 https://imagej.nih.gov/ij/ Imaris 8.1.2 Oxford Instruments https://imaris.oxinst.com/ Prism versions 6 and 8 GraphPad Software https://www.graphpad.com/scientific- software/prism/ R R Core Team, 2020 https://www.R-project.org Other 34 g blunt NanoFil needle Tip World Precision Instruments CatNF34BL-2 Cannulas: Single Guide Cannula for Mice Bilaney Consultants Cat#C313GS-5/SPC Cannulas: Dummy Cannula Bilaney Consultants Cat#C313DCS-5/SPC Cannulas: Internal Cannula (injector) Bilaney Consultants Cat#C313IS-5/SPC Cryostat: CM1950 Leica Biosystems https://www.leicabiosystems.com/histology- equipment/cryostats/leica-cm1950/ Digitizer: Digidata 1440A Molecular Devices N/A Micropipette puller: P-97 Sutter Instrument https://www.sutter.com/MICROPIPETTE/ p-97.html Micropipettes: borosilicate glass (O.D. .. REAGENT or RESOURCE SOURCE IDENTIFIER TNB Blocking Buffer Akoya Biosciences Cat#FP1012 TSA Plus Cyanine 3 (Cy3) Akoya Biosciences Cat#NEL744001KT TSA Plus Cyanine 5 (Cy5) Akoya Biosciences Cat#NEL745001KT TSA Plus Fluorescein (FITC) Akoya Biosciences Cat#NEL741001KT VECTASTAIN Elite ABC-Peroxidase Kit Vector Laboratories Cat#PK-7100; RRID: AB_2336827 Deposited data RNA-seq data from hypothalamic neurons (C57BL/6N mice, 2-4 weeks-old) Romanov et al., 2017 GEO: GSE74672 Experimental models: Organisms/strains Mouse: C57BL/6J Charles River N/A Mouse: C57BL/6J Janvier N/A Mouse: CB1-KO: Cnr1 tm1.1Ltz Marsicano et al., 2002 RRID:MGI:2182924 Mouse: POMC-Cre: Tg(Pomc1-cre)16Lowl/J The Jackson Laboratory Cat#JAX:005965; RRID: IMSR_JAX:005965 Mouse: POMC-eGFP: C57BL/6J-Tg(Pomc-EGFP)1Low/J The Jackson Laboratory Cat#JAX:009593; RRID: IMSR_JAX:009593 Mouse: Rosy: B6.129X1-Gt(ROSA)26Sortm1(EYFP)Cos/J The Jackson Laboratory Cat#JAX:006148; RRID: IMSR_JAX:006148 Mouse: Rptor-Flox: B6.Cg-Rptortm1.1Dmsa/J The Jackson Laboratory Cat#JAX:013188; RRID: IMSR_JAX:013188 Mouse: Rictor-Flox: Ptprcb Thy1a Rictortm1.1Klg/SjmJ The Jackson Laboratory Cat#JAX:020649; RRID: IMSR_JAX:020649 Mouse: CB1-Flox: Cnr1 tm1.2Ltz Marsicano et al., 2003 RRID: MGI:3045419 Mouse: POMC-CreERT2: C57BL/6J-Tg(Pomc-creERT2) Berglund et al., 2013 N/A Mouse: Ai6: B6.Cg-Gt(ROSA)26Sortm6(CAG-ZsGreen1)Hze/J The Jackson Laboratory Cat# JAX:007906; RRID: IMSR_JAX:007906 Oligonucleotides PCR primers used for mouse genotyping, see Table S5 This paper N/A PCR primers used for synthesizing AgRP probe (double FISH) Allen Brain Atlas #RP_050419_04_D06 PCR primers used for synthesizing POMC probe (double FISH) Allen Brain Atlas #RP_Baylor_102974 PCR primers used for synthesizing POMC probe (triple FISH): Forward: GCAGTGACTAAGAGAGGCCACT Reverse: ATTTAGGTGACACTATAGAAGAGGAC TGCCATCTCCCCACAC This paper N/A PCR primers used for synthesizing Gad67 probe (triple FISH): Forward: GAAAGGGCCAATTCAGTCAC Reverse: ATTTAGGTGACACTATAGAAGAGCTGCC TTCAGTGAGATGGCCTAG This paper N/A PCR primers used for synthesizing vglut2 probe (triple FISH): Forward: TCATTGCTGCACTCGTCCACTA Reverse: ATTTAGGTGACACTATAGAAGAGCC CTGGGATAGTTTGCAGTCCA This paper N/A Recombinant DNA Plasmid: Gq-coupled human M3 muscarinic DREADD (hM3Dq) fused to mCherry Alexander et al., 2009 N/A Plasmid: pAAV-Ef1a-DIO-hChR2(H134R)mCherry-WPRE-pA Kozorovitskiy et al., 2012 Addgene Plasmid #37082 RRID:Addgene_37082 Plasmid: CAG-DIO rAAV Atasoy et al., 2008 N/A Software and algorithms Adobe Illustrator CS5 Adobe Systems Software N/A AxonpCLAMP 10 Molecular Devices https://support.moleculardevices.com/s/ article/Axon-pCLAMP-10-ElectrophysiologyData-Acquisition-Analysis-SoftwareDownload-Page (Continued on next page) e3 Cell Reports 37, 109800, October 12, 2021
Mouse Assay:Article Title: Functional heterogeneity of POMC neurons relies on mTORC1 signaling.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Database for Annotation, Visualization and Integrated Discovery (DAVID) Bioinformatics Resources 6.7 Dennis et al., 2003 https://david.ncifcrf.gov/ Genepattern 3.9.8 Reich et al., 2006 https://cloud.genepattern.org/gp/pages/ login.jsf HALO Indica Labs Inc. https://indicalab.com/halo/ ImageJ Schneider et al., 2012 https://imagej.nih.gov/ij/ Imaris 8.1.2 Oxford Instruments https://imaris.oxinst.com/ Prism versions 6 and 8 GraphPad Software https://www.graphpad.com/scientific- software/prism/ R R Core Team, 2020 https://www.R-project.org Other 34 g blunt NanoFil needle Tip World Precision Instruments CatNF34BL-2 Cannulas: Single Guide Cannula for Mice Bilaney Consultants Cat#C313GS-5/SPC Cannulas: Dummy Cannula Bilaney Consultants Cat#C313DCS-5/SPC Cannulas: Internal Cannula (injector) Bilaney Consultants Cat#C313IS-5/SPC Cryostat: CM1950 Leica Biosystems https://www.leicabiosystems.com/histology- equipment/cryostats/leica-cm1950/ Digitizer: Digidata 1440A Molecular Devices N/A Micropipette puller: P-97 Sutter Instrument https://www.sutter.com/MICROPIPETTE/ p-97.html Micropipettes: borosilicate glass (O.D. .. REAGENT or RESOURCE SOURCE IDENTIFIER TNB Blocking Buffer Akoya Biosciences Cat#FP1012 TSA Plus Cyanine 3 (Cy3) Akoya Biosciences Cat#NEL744001KT TSA Plus Cyanine 5 (Cy5) Akoya Biosciences Cat#NEL745001KT TSA Plus Fluorescein (FITC) Akoya Biosciences Cat#NEL741001KT VECTASTAIN Elite ABC-Peroxidase Kit Vector Laboratories Cat#PK-7100; RRID: AB_2336827 Deposited data RNA-seq data from hypothalamic neurons (C57BL/6N mice, 2-4 weeks-old) Romanov et al., 2017 GEO: GSE74672 Experimental models: Organisms/strains Mouse: C57BL/6J Charles River N/A Mouse: C57BL/6J Janvier N/A Mouse: CB1-KO: Cnr1 tm1.1Ltz Marsicano et al., 2002 RRID:MGI:2182924 Mouse: POMC-Cre: Tg(Pomc1-cre)16Lowl/J The Jackson Laboratory Cat#JAX:005965; RRID: IMSR_JAX:005965 Mouse: POMC-eGFP: C57BL/6J-Tg(Pomc-EGFP)1Low/J The Jackson Laboratory Cat#JAX:009593; RRID: IMSR_JAX:009593 Mouse: Rosy: B6.129X1-Gt(ROSA)26Sortm1(EYFP)Cos/J The Jackson Laboratory Cat#JAX:006148; RRID: IMSR_JAX:006148 Mouse: Rptor-Flox: B6.Cg-Rptortm1.1Dmsa/J The Jackson Laboratory Cat#JAX:013188; RRID: IMSR_JAX:013188 Mouse: Rictor-Flox: Ptprcb Thy1a Rictortm1.1Klg/SjmJ The Jackson Laboratory Cat#JAX:020649; RRID: IMSR_JAX:020649 Mouse: CB1-Flox: Cnr1 tm1.2Ltz Marsicano et al., 2003 RRID: MGI:3045419 Mouse: POMC-CreERT2: C57BL/6J-Tg(Pomc-creERT2) Berglund et al., 2013 N/A Mouse: Ai6: B6.Cg-Gt(ROSA)26Sortm6(CAG-ZsGreen1)Hze/J The Jackson Laboratory Cat# JAX:007906; RRID: IMSR_JAX:007906 Oligonucleotides PCR primers used for mouse genotyping, see Table S5 This paper N/A PCR primers used for synthesizing AgRP probe (double FISH) Allen Brain Atlas #RP_050419_04_D06 PCR primers used for synthesizing POMC probe (double FISH) Allen Brain Atlas #RP_Baylor_102974 PCR primers used for synthesizing POMC probe (triple FISH): Forward: GCAGTGACTAAGAGAGGCCACT Reverse: ATTTAGGTGACACTATAGAAGAGGAC TGCCATCTCCCCACAC This paper N/A PCR primers used for synthesizing Gad67 probe (triple FISH): Forward: GAAAGGGCCAATTCAGTCAC Reverse: ATTTAGGTGACACTATAGAAGAGCTGCC TTCAGTGAGATGGCCTAG This paper N/A PCR primers used for synthesizing vglut2 probe (triple FISH): Forward: TCATTGCTGCACTCGTCCACTA Reverse: ATTTAGGTGACACTATAGAAGAGCC CTGGGATAGTTTGCAGTCCA This paper N/A Recombinant DNA Plasmid: Gq-coupled human M3 muscarinic DREADD (hM3Dq) fused to mCherry Alexander et al., 2009 N/A Plasmid: pAAV-Ef1a-DIO-hChR2(H134R)mCherry-WPRE-pA Kozorovitskiy et al., 2012 Addgene Plasmid #37082 RRID:Addgene_37082 Plasmid: CAG-DIO rAAV Atasoy et al., 2008 N/A Software and algorithms Adobe Illustrator CS5 Adobe Systems Software N/A AxonpCLAMP 10 Molecular Devices https://support.moleculardevices.com/s/ article/Axon-pCLAMP-10-ElectrophysiologyData-Acquisition-Analysis-SoftwareDownload-Page (Continued on next page) e3 Cell Reports 37, 109800, October 12, 2021
|
World Precision Instruments is a verified supplier 
World Precision Instruments manufactures this product 